Transcript: Human NM_014235.5

Homo sapiens ubiquitin like 4A (UBL4A), mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
UBL4A (8266)
Length:
2327
CDS:
32..505

Additional Resources:

NCBI RefSeq record:
NM_014235.5
NBCI Gene record:
UBL4A (8266)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014235.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007667 GCAGTTCAGGTGATACATTTA pLKO.1 1876 3UTR 100% 13.200 18.480 N UBL4A n/a
2 TRCN0000277821 GCAGTTCAGGTGATACATTTA pLKO_005 1876 3UTR 100% 13.200 18.480 N UBL4A n/a
3 TRCN0000007671 GCTGGACGACATCGAACGGTT pLKO.1 424 CDS 100% 0.880 1.232 N UBL4A n/a
4 TRCN0000286036 GCTGGACGACATCGAACGGTT pLKO_005 424 CDS 100% 0.880 1.232 N UBL4A n/a
5 TRCN0000007670 GAGAAGGTGCTACTAGAAGAA pLKO.1 254 CDS 100% 4.950 3.465 N UBL4A n/a
6 TRCN0000277751 GAGAAGGTGCTACTAGAAGAA pLKO_005 254 CDS 100% 4.950 3.465 N UBL4A n/a
7 TRCN0000007668 CCCTGAAGTGACTGAGACAAT pLKO.1 463 CDS 100% 4.950 2.970 N UBL4A n/a
8 TRCN0000277819 CCCTGAAGTGACTGAGACAAT pLKO_005 463 CDS 100% 4.950 2.970 N UBL4A n/a
9 TRCN0000007669 GCAGCTGATCTCCAAAGTCTT pLKO.1 319 CDS 100% 4.950 2.970 N UBL4A n/a
10 TRCN0000277750 GCAGCTGATCTCCAAAGTCTT pLKO_005 319 CDS 100% 4.950 2.970 N UBL4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014235.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01878 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01878 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466142 ACCGAAGAATAATCGTTTGCGATC pLX_317 75.9% 100% 100% V5 n/a
Download CSV