Transcript: Human NM_014262.5

Homo sapiens prolyl 3-hydroxylase 3 (P3H3), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
P3H3 (10536)
Length:
2631
CDS:
35..2245

Additional Resources:

NCBI RefSeq record:
NM_014262.5
NBCI Gene record:
P3H3 (10536)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014262.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064814 GAGGGCCTATTACCAGTTGAA pLKO.1 517 CDS 100% 4.950 6.930 N P3H3 n/a
2 TRCN0000064813 CATGGCTAAGTACAGACGAAT pLKO.1 613 CDS 100% 4.950 3.465 N P3H3 n/a
3 TRCN0000064816 CAGGAGTGGATAGAAGCCAAA pLKO.1 2078 CDS 100% 4.050 2.835 N P3H3 n/a
4 TRCN0000064817 ACCTACTGGAAGGATGTCCTT pLKO.1 1355 CDS 100% 2.640 1.848 N P3H3 n/a
5 TRCN0000064815 GAGGAAGAAATGCCCAGCAAA pLKO.1 2138 CDS 100% 4.950 2.970 N P3H3 n/a
6 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 2124 CDS 100% 4.950 2.475 Y Adam32 n/a
7 TRCN0000156756 GAGGAAGAGGAAGAGGAAGAT pLKO.1 2126 CDS 100% 4.950 2.475 Y NPM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014262.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11518 pDONR223 100% 74.8% 74.8% None 1_555del n/a
2 ccsbBroad304_11518 pLX_304 0% 74.8% 74.8% V5 1_555del n/a
3 TRCN0000470017 GGCCCGTAATGAACACTACGATGC pLX_317 26.5% 74.8% 74.8% V5 1_555del n/a
Download CSV