Transcript: Human NM_014289.4

Homo sapiens calpain 6 (CAPN6), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CAPN6 (827)
Length:
3532
CDS:
129..2054

Additional Resources:

NCBI RefSeq record:
NM_014289.4
NBCI Gene record:
CAPN6 (827)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014289.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432563 ATCTGATTGTGGGCAACATTA pLKO_005 313 CDS 100% 13.200 18.480 N CAPN6 n/a
2 TRCN0000003563 CGAATGGGAAGACCTGACAAT pLKO.1 1362 CDS 100% 4.950 6.930 N CAPN6 n/a
3 TRCN0000431697 GTTTGACCATCACTGATATTA pLKO_005 664 CDS 100% 15.000 10.500 N CAPN6 n/a
4 TRCN0000003564 GAGAAGAAGTATGCCAATGAA pLKO.1 1713 CDS 100% 5.625 3.938 N CAPN6 n/a
5 TRCN0000003566 CCAACCATAAGGAACAGGAAT pLKO.1 433 CDS 100% 4.950 3.465 N CAPN6 n/a
6 TRCN0000003565 CCGTGATCTGAAGTCTCTGTA pLKO.1 1943 CDS 100% 4.950 3.465 N CAPN6 n/a
7 TRCN0000003567 CCAGACATATTACAGCCAGTT pLKO.1 2961 3UTR 100% 4.050 2.835 N CAPN6 n/a
8 TRCN0000435635 ACATCAGCTTCAAGGTTATTT pLKO_005 2008 CDS 100% 15.000 9.000 N CAPN6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014289.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00217 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00217 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481029 TCCTTTCGCCGGGCTAGCGGTCAC pLX_317 24.3% 100% 100% V5 n/a
Download CSV