Transcript: Human NM_014314.4

Homo sapiens DExD/H-box helicase 58 (DDX58), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
DDX58 (23586)
Length:
4628
CDS:
31..2808

Additional Resources:

NCBI RefSeq record:
NM_014314.4
NBCI Gene record:
DDX58 (23586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014314.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230211 ATCACGGATTAGCGACAAATT pLKO_005 1422 CDS 100% 13.200 18.480 N DDX58 n/a
2 TRCN0000230212 AGCACTTGTGGACGCTTTAAA pLKO_005 1941 CDS 100% 15.000 10.500 N DDX58 n/a
3 TRCN0000230213 CCCAATACAAATGGATTATTT pLKO_005 4198 3UTR 100% 15.000 10.500 N DDX58 n/a
4 TRCN0000230210 GCAAGCCTTCCAGGATTATAT pLKO_005 57 CDS 100% 15.000 10.500 N DDX58 n/a
5 TRCN0000218309 TTATCCCAACCGATATCATTT pLKO_005 383 CDS 100% 13.200 9.240 N DDX58 n/a
6 TRCN0000153897 CCACTTAAACCCAGAGACAAT pLKO.1 1896 CDS 100% 4.950 3.465 N DDX58 n/a
7 TRCN0000151446 CCATGTGAAGTACAAGACATT pLKO.1 2655 CDS 100% 4.950 3.465 N DDX58 n/a
8 TRCN0000151583 GCAAGATCTTACTCAGAGATT pLKO.1 1779 CDS 100% 4.950 3.465 N DDX58 n/a
9 TRCN0000153712 CCAGAATTATCCCAACCGATA pLKO.1 377 CDS 100% 4.050 2.835 N DDX58 n/a
10 TRCN0000152922 CCAGAGAAACTTGCCAGTTAT pLKO.1 4024 3UTR 100% 13.200 7.920 N DDX58 n/a
11 TRCN0000103889 GCAATGAGAATCCTAAACTAA pLKO.1 1844 CDS 100% 5.625 3.938 N Ddx58 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014314.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.