Transcript: Human NM_014323.3

Homo sapiens POZ/BTB and AT hook containing zinc finger 1 (PATZ1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-12
Taxon:
Homo sapiens (human)
Gene:
PATZ1 (23598)
Length:
3895
CDS:
745..2808

Additional Resources:

NCBI RefSeq record:
NM_014323.3
NBCI Gene record:
PATZ1 (23598)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014323.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274414 ACTATCAGCTCCAAGGTATTT pLKO_005 1066 CDS 100% 13.200 18.480 N PATZ1 n/a
2 TRCN0000274379 TGATCACTTGAACGGACATAT pLKO_005 2019 CDS 100% 13.200 18.480 N PATZ1 n/a
3 TRCN0000274417 AGATTGTTCAGTCGGCATTTG pLKO_005 2729 CDS 100% 10.800 15.120 N PATZ1 n/a
4 TRCN0000019250 CCGCTCTAAGTCCTACTTGAA pLKO.1 2586 CDS 100% 4.950 6.930 N PATZ1 n/a
5 TRCN0000019252 GTCATCAAACAGTCCAACGTA pLKO.1 1207 CDS 100% 3.000 4.200 N PATZ1 n/a
6 TRCN0000019249 GCCTCCTACTTAAAGGTCCAT pLKO.1 2263 CDS 100% 2.640 3.696 N PATZ1 n/a
7 TRCN0000274415 CTAGGGTCTCCACCTACTTAT pLKO_005 3244 3UTR 100% 13.200 10.560 N PATZ1 n/a
8 TRCN0000019253 CGAGTACTTTGAGTCGGTGTT pLKO.1 933 CDS 100% 4.050 3.240 N PATZ1 n/a
9 TRCN0000274416 CGAGTACTTTGAGTCGGTGTT pLKO_005 933 CDS 100% 4.050 3.240 N PATZ1 n/a
10 TRCN0000019251 GCAACAAAGAAGGCCAGAAAT pLKO.1 2381 CDS 100% 13.200 9.240 N PATZ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014323.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07913 pDONR223 100% 72.9% 65.4% None (many diffs) n/a
2 ccsbBroad304_07913 pLX_304 0% 72.9% 65.4% V5 (many diffs) n/a
3 TRCN0000476680 TGCATTAGAGCTAATCTACGCGCG pLX_317 18.9% 72.9% 65.4% V5 (many diffs) n/a
Download CSV