Transcript: Human NM_014332.3

Homo sapiens small muscle protein X-linked (SMPX), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
SMPX (23676)
Length:
885
CDS:
188..454

Additional Resources:

NCBI RefSeq record:
NM_014332.3
NBCI Gene record:
SMPX (23676)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014332.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147781 GATGGATTCAATAGCTCACTA pLKO.1 498 3UTR 100% 4.950 6.930 N SMPX n/a
2 TRCN0000432218 TAGAGCCATCCAGGCAAATAT pLKO_005 220 CDS 100% 15.000 10.500 N SMPX n/a
3 TRCN0000423837 ATATTCCAATGGGAGCCTTTC pLKO_005 243 CDS 100% 6.000 4.200 N SMPX n/a
4 TRCN0000149323 GAGGCAGAAGATGGATTCAAT pLKO.1 489 3UTR 100% 5.625 3.938 N SMPX n/a
5 TRCN0000129742 CACAGAACAAATTAGCCCATA pLKO.1 654 3UTR 100% 4.050 2.835 N SMPX n/a
6 TRCN0000128897 GATGATTGTGAACCTCCTGAA pLKO.1 538 3UTR 100% 4.050 2.835 N SMPX n/a
7 TRCN0000129511 GAGAAGAAGCCAATTCCAGGA pLKO.1 344 CDS 100% 2.160 1.512 N SMPX n/a
8 TRCN0000128816 GATGAGGAGAAGAAGCCAATT pLKO.1 338 CDS 100% 10.800 6.480 N SMPX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014332.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02829 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02829 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478623 ATACTGCGGGGCTCACACCGGCGC pLX_317 100% 100% 100% V5 n/a
Download CSV