Transcript: Human NM_014335.3

Homo sapiens EP300 interacting inhibitor of differentiation 1 (EID1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
EID1 (23741)
Length:
2040
CDS:
44..607

Additional Resources:

NCBI RefSeq record:
NM_014335.3
NBCI Gene record:
EID1 (23741)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014335.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135114 CTCGGCTGTGATGAGATTATT pLKO.1 575 CDS 100% 15.000 21.000 N EID1 n/a
2 TRCN0000312425 CTCGGCTGTGATGAGATTATT pLKO_005 575 CDS 100% 15.000 21.000 N EID1 n/a
3 TRCN0000138936 GCCGACAAGATGTTTCTGAGA pLKO.1 434 CDS 100% 2.640 3.696 N EID1 n/a
4 TRCN0000134015 CCTATGGCTTTGACTTTGTTA pLKO.1 850 3UTR 100% 5.625 3.938 N EID1 n/a
5 TRCN0000312426 CCTATGGCTTTGACTTTGTTA pLKO_005 850 3UTR 100% 5.625 3.938 N EID1 n/a
6 TRCN0000135578 GAAGAAGCCGACAAGATGTTT pLKO.1 428 CDS 100% 5.625 3.938 N EID1 n/a
7 TRCN0000312423 GAAGAAGCCGACAAGATGTTT pLKO_005 428 CDS 100% 5.625 3.938 N EID1 n/a
8 TRCN0000134243 CCTTACTAAGATGCTGAAGTT pLKO.1 1886 3UTR 100% 4.950 3.465 N EID1 n/a
9 TRCN0000138887 GAACTCGGCTGTGATGAGATT pLKO.1 572 CDS 100% 4.950 3.465 N EID1 n/a
10 TRCN0000136246 GCTGAAGTTCTAGGAGAGTAA pLKO.1 1898 3UTR 100% 4.950 3.465 N EID1 n/a
11 TRCN0000134461 GATGTTTCTGAGAACAAGAGA pLKO.1 442 CDS 100% 3.000 2.100 N EID1 n/a
12 TRCN0000312477 GATGTTTCTGAGAACAAGAGA pLKO_005 442 CDS 100% 3.000 2.100 N EID1 n/a
13 TRCN0000138359 CGAGGAATTTGATGACTGGGA pLKO.1 340 CDS 100% 0.660 0.462 N EID1 n/a
14 TRCN0000138170 GCTGTATGAAGAGAGCAGTGA pLKO.1 70 CDS 100% 2.640 1.584 N EID1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014335.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02836 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02836 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468439 CGAGTAGTGTGTAACCCCATCTCC pLX_317 77.1% 100% 100% V5 n/a
Download CSV