Transcript: Human NM_014368.5

Homo sapiens LIM homeobox 6 (LHX6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
LHX6 (26468)
Length:
3574
CDS:
218..1396

Additional Resources:

NCBI RefSeq record:
NM_014368.5
NBCI Gene record:
LHX6 (26468)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014368.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413472 CGAGATCCTGGACCGATATCT pLKO_005 529 CDS 100% 5.625 7.875 N LHX6 n/a
2 TRCN0000431921 TACATTGAGAGTCAGGTACAG pLKO_005 1262 CDS 100% 4.050 5.670 N LHX6 n/a
3 TRCN0000017141 GCAGGTTATGCAGGCGCAGTT pLKO.1 997 CDS 100% 1.350 1.890 N LHX6 n/a
4 TRCN0000413377 GCCAACGGCCTTCTCATTTAC pLKO_005 1734 3UTR 100% 13.200 10.560 N LHX6 n/a
5 TRCN0000017139 CGTCCACCTCAAAGCCGATAT pLKO.1 1324 CDS 100% 10.800 7.560 N LHX6 n/a
6 TRCN0000017138 CTACGACACCATGATTGAGAA pLKO.1 856 CDS 100% 4.950 3.465 N LHX6 n/a
7 TRCN0000017140 GATGGACTACTTCAGCCGATT pLKO.1 664 CDS 100% 4.050 2.835 N LHX6 n/a
8 TRCN0000017142 GCTGTCCACTGGTGAGGAGTT pLKO.1 799 CDS 100% 1.350 0.945 N LHX6 n/a
9 TRCN0000454932 CAACTTCAGCTGATTACAATA pLKO_005 1686 3UTR 100% 13.200 7.920 N LHX6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014368.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11825 pDONR223 100% 92.6% 92.6% None 1_87del n/a
2 ccsbBroad304_11825 pLX_304 0% 92.6% 92.6% V5 1_87del n/a
3 TRCN0000466117 CGATGCGGTCTTCATCTAAGGATC pLX_317 29.4% 92.6% 92.6% V5 1_87del n/a
Download CSV