Transcript: Human NM_014391.2

Homo sapiens ankyrin repeat domain 1 (ANKRD1), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ANKRD1 (27063)
Length:
1994
CDS:
249..1208

Additional Resources:

NCBI RefSeq record:
NM_014391.2
NBCI Gene record:
ANKRD1 (27063)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014391.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148262 GAGAATAAACTGCCAGTAGTA pLKO.1 636 CDS 100% 4.950 6.930 N ANKRD1 n/a
2 TRCN0000148667 CCAGTTGTAAAGGAACCAGAA pLKO.1 561 CDS 100% 4.050 5.670 N ANKRD1 n/a
3 TRCN0000426866 ATGATCCGACTCCTGATTATG pLKO_005 1047 CDS 100% 13.200 10.560 N ANKRD1 n/a
4 TRCN0000412849 AGCATGCTTGGAAGGACATTT pLKO_005 725 CDS 100% 13.200 9.240 N ANKRD1 n/a
5 TRCN0000147060 CAGAATGGAACCAAAGCAATA pLKO.1 1134 CDS 100% 10.800 7.560 N ANKRD1 n/a
6 TRCN0000149839 CGGATCTCAACATCAAGAACT pLKO.1 1075 CDS 100% 4.950 3.465 N ANKRD1 n/a
7 TRCN0000149714 GCAAAGTTCAAGTGCCTACTT pLKO.1 1542 3UTR 100% 4.950 3.465 N ANKRD1 n/a
8 TRCN0000146636 CCAGATGTTTGTGATGAGTAT pLKO.1 684 CDS 100% 4.950 2.970 N ANKRD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014391.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02985 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02985 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475310 ACAGTTTAGAAAACCGAATGTGGG pLX_317 58.2% 100% 100% V5 n/a
Download CSV