Transcript: Human NM_014421.3

Homo sapiens dickkopf WNT signaling pathway inhibitor 2 (DKK2), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
DKK2 (27123)
Length:
3654
CDS:
723..1502

Additional Resources:

NCBI RefSeq record:
NM_014421.3
NBCI Gene record:
DKK2 (27123)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014421.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435726 AGATCGAAACCACGGTCATTA pLKO_005 1166 CDS 100% 13.200 18.480 N DKK2 n/a
2 TRCN0000033391 CCTACGATCATCAGACTGCAT pLKO.1 1271 CDS 100% 2.640 3.696 N DKK2 n/a
3 TRCN0000413176 CACTAAGATGTCACATATAAA pLKO_005 1229 CDS 100% 15.000 10.500 N DKK2 n/a
4 TRCN0000420332 TCTATTCAACGTTAGAGTTTA pLKO_005 1890 3UTR 100% 13.200 9.240 N DKK2 n/a
5 TRCN0000033392 CAACGCAAGAAGGGTTCTCAT pLKO.1 1371 CDS 100% 4.950 3.465 N DKK2 n/a
6 TRCN0000033390 CCTACCCTTGTAGCAGTGATA pLKO.1 946 CDS 100% 4.950 3.465 N DKK2 n/a
7 TRCN0000033393 GAGTGTGAAGTTGGGAGGTAT pLKO.1 969 CDS 100% 4.950 3.465 N DKK2 n/a
8 TRCN0000033389 GCTGCAATAATGGCATCTGTA pLKO.1 1084 CDS 100% 4.950 3.465 N DKK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014421.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08058 pDONR223 100% 99.8% 99.6% None 437G>A n/a
2 ccsbBroad304_08058 pLX_304 0% 99.8% 99.6% V5 437G>A n/a
3 TRCN0000471187 ATCACCTTAGTCCGGTATGTAAAC pLX_317 48.5% 99.8% 99.6% V5 437G>A n/a
Download CSV