Transcript: Human NM_014569.4

Homo sapiens zinc finger with KRAB and SCAN domains 5 (ZKSCAN5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ZKSCAN5 (23660)
Length:
5182
CDS:
212..2731

Additional Resources:

NCBI RefSeq record:
NM_014569.4
NBCI Gene record:
ZKSCAN5 (23660)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014569.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235855 GTTGTAGAATAGCTCTTAATT pLKO_005 2725 CDS 100% 15.000 21.000 N ZKSCAN5 n/a
2 TRCN0000235857 TTCAGTACGTTAGCCTAATTG pLKO_005 2223 CDS 100% 13.200 18.480 N ZKSCAN5 n/a
3 TRCN0000016401 CGCATCTGATCGAACACCTAA pLKO.1 1539 CDS 100% 4.950 6.930 N ZKSCAN5 n/a
4 TRCN0000235858 ATCCCATCAGTGTCGTGAATG pLKO_005 2188 CDS 100% 10.800 8.640 N ZKSCAN5 n/a
5 TRCN0000016399 GCCTCAAACTTTATTCAGCAT pLKO.1 1283 CDS 100% 2.640 2.112 N ZKSCAN5 n/a
6 TRCN0000235856 GAGAGGACAGATCCCATAAAT pLKO_005 2681 CDS 100% 15.000 10.500 N ZKSCAN5 n/a
7 TRCN0000016402 GCTGGAGTTGTAGCCTCTTTA pLKO.1 2643 CDS 100% 13.200 9.240 N ZKSCAN5 n/a
8 TRCN0000016398 CCCACACCAAACAACATCAAA pLKO.1 2484 CDS 100% 5.625 3.938 N ZKSCAN5 n/a
9 TRCN0000016400 GCTGGATAGAAAGCAGGGAAT pLKO.1 1738 CDS 100% 4.050 2.835 N ZKSCAN5 n/a
10 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5064 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014569.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07924 pDONR223 100% 99.9% 99.8% None 2377A>G n/a
2 ccsbBroad304_07924 pLX_304 0% 99.9% 99.8% V5 2377A>G n/a
3 TRCN0000474974 GAGAGTTTCTCCAGGGAGCGCTTC pLX_317 21.2% 99.9% 99.8% V5 2377A>G n/a
Download CSV