Transcript: Human NM_014594.3

Homo sapiens zinc finger protein 354C (ZNF354C), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
ZNF354C (30832)
Length:
5893
CDS:
349..2013

Additional Resources:

NCBI RefSeq record:
NM_014594.3
NBCI Gene record:
ZNF354C (30832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014594.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018258 CCCGTCTAGGTTTCAAGACTT pLKO.1 590 CDS 100% 4.950 6.930 N ZNF354C n/a
2 TRCN0000018262 CGTATTGTAACCCTTATCGAA pLKO.1 1531 CDS 100% 3.000 4.200 N ZNF354C n/a
3 TRCN0000018259 CAACCAGTATTCATCCTTTAA pLKO.1 1611 CDS 100% 13.200 10.560 N ZNF354C n/a
4 TRCN0000018261 CTTACCCAGTATCAGAGATTT pLKO.1 1963 CDS 100% 13.200 10.560 N ZNF354C n/a
5 TRCN0000218590 ACAGGTGAGAAACCCTATAAA pLKO_005 1399 CDS 100% 15.000 9.000 N Zfp936 n/a
6 TRCN0000018260 GAAACCATACAAGTCTTGAAT pLKO.1 821 CDS 100% 5.625 3.375 N ZNF354C n/a
7 TRCN0000148848 CATACAGGTGAGAAACCCTAT pLKO.1 1396 CDS 100% 4.050 2.025 Y ZNF260 n/a
8 TRCN0000107990 GCATCAAAGAATCCATACAAA pLKO.1 1383 CDS 100% 5.625 2.813 Y ZNF789 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014594.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11919 pDONR223 100% 87.4% 85.1% None 748G>A;1416_1417delGT;1458_1662del n/a
2 ccsbBroad304_11919 pLX_304 0% 87.4% 85.1% V5 748G>A;1416_1417delGT;1458_1662del n/a
3 TRCN0000476599 TGACGCCACCCCGATGCATACCGT pLX_317 28.4% 87.4% 85.1% V5 748G>A;1416_1417delGT;1458_1662del n/a
Download CSV