Transcript: Human NM_014599.6

Homo sapiens MAGE family member D2 (MAGED2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MAGED2 (10916)
Length:
2081
CDS:
118..1938

Additional Resources:

NCBI RefSeq record:
NM_014599.6
NBCI Gene record:
MAGED2 (10916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014599.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350693 ATACTCGGCCCAAGGTCAAAG pLKO_005 617 CDS 100% 10.800 15.120 N MAGED2 n/a
2 TRCN0000350738 GAAGGTATTTGGGATTCAATT pLKO_005 1104 CDS 100% 13.200 9.240 N MAGED2 n/a
3 TRCN0000322634 AGGGTCTCAAAGGCCCTAATG pLKO_005 727 CDS 100% 10.800 7.560 N MAGED2 n/a
4 TRCN0000322563 CATTGAACGAGCAGGCTATTC pLKO_005 1077 CDS 100% 10.800 7.560 N MAGED2 n/a
5 TRCN0000115791 CTCTCCCTGAGATCACCTAAA pLKO.1 844 CDS 100% 10.800 7.560 N MAGED2 n/a
6 TRCN0000322564 GGCTGATACAAAGGTCAATAC pLKO_005 504 CDS 100% 10.800 7.560 N MAGED2 n/a
7 TRCN0000115789 CAAAGCCAAGAAAGCCCGAAA pLKO.1 633 CDS 100% 4.050 2.835 N MAGED2 n/a
8 TRCN0000115787 CAAAGAATACACTGATGTGTA pLKO.1 1047 CDS 100% 0.495 0.347 N MAGED2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014599.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02558 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02558 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467238 GGAACCGAGTTCATGCCAATAGCC pLX_317 18% 100% 100% V5 n/a
Download CSV