Transcript: Human NM_014685.4

Homo sapiens homocysteine inducible ER protein with ubiquitin like domain 1 (HERPUD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
HERPUD1 (9709)
Length:
2853
CDS:
104..1279

Additional Resources:

NCBI RefSeq record:
NM_014685.4
NBCI Gene record:
HERPUD1 (9709)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014685.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004409 CACCGTTGTTATGTACCTGCA pLKO.1 991 CDS 100% 2.160 3.024 N HERPUD1 n/a
2 TRCN0000004410 CCTCCTCCTGACGTTGTAAAT pLKO.1 1070 CDS 100% 13.200 9.240 N HERPUD1 n/a
3 TRCN0000318634 CCTCCTCCTGACGTTGTAAAT pLKO_005 1070 CDS 100% 13.200 9.240 N HERPUD1 n/a
4 TRCN0000004412 GTGTGGATGATGATATGCTTT pLKO.1 1389 3UTR 100% 4.950 3.465 N HERPUD1 n/a
5 TRCN0000318635 GTGTGGATGATGATATGCTTT pLKO_005 1389 3UTR 100% 4.950 3.465 N HERPUD1 n/a
6 TRCN0000010873 TCTGGGAAGCTGTTGTTGGAT pLKO.1 278 CDS 100% 3.000 2.100 N HERPUD1 n/a
7 TRCN0000318699 TCTGGGAAGCTGTTGTTGGAT pLKO_005 278 CDS 100% 3.000 2.100 N HERPUD1 n/a
8 TRCN0000004411 TGTGCAATGTGAAGAGTCCTT pLKO.1 357 CDS 100% 2.640 1.848 N HERPUD1 n/a
9 TRCN0000318633 TGTGCAATGTGAAGAGTCCTT pLKO_005 357 CDS 100% 2.640 1.848 N HERPUD1 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2714 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2714 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014685.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02230 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02230 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478840 CCTGATACCTTCCGGGCTCATCGC pLX_317 39.3% 100% 100% V5 n/a
Download CSV