Transcript: Human NM_014718.4

Homo sapiens calsyntenin 3 (CLSTN3), mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
CLSTN3 (9746)
Length:
4013
CDS:
279..3149

Additional Resources:

NCBI RefSeq record:
NM_014718.4
NBCI Gene record:
CLSTN3 (9746)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014718.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364768 ATCCTGAGGCAGGCTCGTTAT pLKO_005 2553 CDS 100% 10.800 15.120 N CLSTN3 n/a
2 TRCN0000364772 CACGCATGTCGGATGAGATTG pLKO_005 2362 CDS 100% 10.800 15.120 N CLSTN3 n/a
3 TRCN0000377326 GGGCTGGACTATAGGGATTTC pLKO_005 1932 CDS 100% 10.800 15.120 N CLSTN3 n/a
4 TRCN0000364771 TCAACGATGTGAACGAGTTTG pLKO_005 682 CDS 100% 10.800 15.120 N CLSTN3 n/a
5 TRCN0000056499 CTCGGAAATGAATGGCCGTTA pLKO.1 2624 CDS 100% 4.050 5.670 N CLSTN3 n/a
6 TRCN0000056498 CCTACTGAATCCACCACTCTT pLKO.1 410 CDS 100% 4.950 3.960 N CLSTN3 n/a
7 TRCN0000369519 GCTGAGTGGCACTGCTCATTT pLKO_005 2210 CDS 100% 13.200 9.240 N CLSTN3 n/a
8 TRCN0000364769 GTGAGAGGCTCTATAAGTTTA pLKO_005 907 CDS 100% 13.200 9.240 N CLSTN3 n/a
9 TRCN0000369518 CCATGGAGTCCTACCAGAATC pLKO_005 3001 CDS 100% 10.800 7.560 N CLSTN3 n/a
10 TRCN0000056501 AGCCTGATCTACTGGTTCAAT pLKO.1 1299 CDS 100% 5.625 3.938 N CLSTN3 n/a
11 TRCN0000056502 GCTTTCCTGCTCGGAAATGAA pLKO.1 2615 CDS 100% 0.563 0.394 N CLSTN3 n/a
12 TRCN0000364770 CATCGTCCCTGCTTCTCTTAT pLKO_005 3603 3UTR 100% 13.200 7.920 N CLSTN3 n/a
13 TRCN0000056500 CTTGGCTTTGTTCCCTGGTAT pLKO.1 1061 CDS 100% 4.950 2.970 N CLSTN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014718.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476700 TCCTCAAGAACCATGTATGTCATT pLX_317 11.4% 99.8% 99.6% V5 (many diffs) n/a
Download CSV