Transcript: Human NM_014728.3

Homo sapiens FERM and PDZ domain containing 4 (FRMPD4), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
FRMPD4 (9758)
Length:
8477
CDS:
507..4475

Additional Resources:

NCBI RefSeq record:
NM_014728.3
NBCI Gene record:
FRMPD4 (9758)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157947 CCACGTCAACAGGATCGAAAT pLKO.1 1901 CDS 100% 10.800 15.120 N FRMPD4 n/a
2 TRCN0000156856 GATGTGGTTCAGGAGCGATTT pLKO.1 1449 CDS 100% 10.800 15.120 N FRMPD4 n/a
3 TRCN0000151341 GCAGACCAAATCATTTCGTTT pLKO.1 1145 CDS 100% 4.950 6.930 N FRMPD4 n/a
4 TRCN0000156979 CCGAATTAGCTTCGTCCCAAA pLKO.1 1361 CDS 100% 4.050 5.670 N FRMPD4 n/a
5 TRCN0000150888 GCGATTAGTTAAAGTCGTGAA pLKO.1 5578 3UTR 100% 4.050 5.670 N FRMPD4 n/a
6 TRCN0000156638 GCCCTAAAGGAGAGCACATAT pLKO.1 5291 3UTR 100% 13.200 9.240 N FRMPD4 n/a
7 TRCN0000151379 GAAGCCCAGATAACATACATA pLKO.1 2205 CDS 100% 5.625 3.938 N FRMPD4 n/a
8 TRCN0000152859 GCCTGAAACTATGGAGACTAA pLKO.1 3500 CDS 100% 4.950 3.465 N FRMPD4 n/a
9 TRCN0000153566 GAGGAGCTAAAGTGTCCTTTA pLKO.1 2446 CDS 100% 1.080 0.756 N FRMPD4 n/a
10 TRCN0000150308 CAGCATTTATTAGTGCTGCAA pLKO.1 985 CDS 100% 0.264 0.185 N FRMPD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465554 ACCGCACTCGCACGGCGTGGGCAC pLX_317 7% 99.8% 99.8% V5 23_24delAGinsCT;3566_3567delGCinsAG n/a
Download CSV