Transcript: Human NM_014729.3

Homo sapiens thymocyte selection associated high mobility group box (TOX), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TOX (9760)
Length:
4076
CDS:
161..1741

Additional Resources:

NCBI RefSeq record:
NM_014729.3
NBCI Gene record:
TOX (9760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014729.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019474 CGGGAATGAATCCTCACCTAA pLKO.1 1296 CDS 100% 4.950 6.930 N TOX n/a
2 TRCN0000019476 CGACTATCAGACTATTATCAA pLKO.1 1570 CDS 100% 5.625 4.500 N TOX n/a
3 TRCN0000019477 CCCTACTATTGCAACAAGTTT pLKO.1 245 CDS 100% 5.625 3.938 N TOX n/a
4 TRCN0000019478 CGATGATACCTCTAAGATCAA pLKO.1 838 CDS 100% 4.950 3.465 N TOX n/a
5 TRCN0000019475 CCCTGAAATCACAGTCTCCAA pLKO.1 505 CDS 100% 2.640 1.848 N TOX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014729.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02236 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02236 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469233 TAGCCGCCGTTACGCCTATTCTCA pLX_317 21.2% 100% 100% V5 n/a
Download CSV