Transcript: Human NM_014746.6

Homo sapiens ring finger protein 144A (RNF144A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
RNF144A (9781)
Length:
5720
CDS:
423..1301

Additional Resources:

NCBI RefSeq record:
NM_014746.6
NBCI Gene record:
RNF144A (9781)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014746.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004415 CCTTCTGATACACTACGATAA pLKO.1 1088 CDS 100% 10.800 15.120 N RNF144A n/a
2 TRCN0000004417 CCACTCCCTTTGTACTTTGCT pLKO.1 1234 CDS 100% 3.000 4.200 N RNF144A n/a
3 TRCN0000421486 ATGTTGAGCTCTTGATCAAAG pLKO_005 571 CDS 100% 10.800 7.560 N RNF144A n/a
4 TRCN0000428023 CCACTCTCTTCAGACAGAATC pLKO_005 1686 3UTR 100% 10.800 7.560 N RNF144A n/a
5 TRCN0000004414 CGATGATTTCCTTCTGATACA pLKO.1 1079 CDS 100% 4.950 3.465 N RNF144A n/a
6 TRCN0000004413 GAACGAGATTGAGTGCATGGT pLKO.1 656 CDS 100% 2.640 1.848 N RNF144A n/a
7 TRCN0000004416 GCTGTGATGGTGTCTACTGTT pLKO.1 3092 3UTR 100% 4.950 2.970 N RNF144A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014746.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07484 pDONR223 100% 99.8% 99.6% None 10A>G n/a
2 ccsbBroad304_07484 pLX_304 0% 99.8% 99.6% V5 10A>G n/a
3 TRCN0000466327 CTTCTATGCCATAGGGAACGGAGT pLX_317 43.9% 99.8% 99.6% V5 10A>G n/a
Download CSV