Transcript: Human NM_014747.3

Homo sapiens regulating synaptic membrane exocytosis 3 (RIMS3), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
RIMS3 (9783)
Length:
7259
CDS:
496..1422

Additional Resources:

NCBI RefSeq record:
NM_014747.3
NBCI Gene record:
RIMS3 (9783)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014747.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413114 ATCCCTCCCAGCCACCTATAT pLKO_005 1059 CDS 100% 13.200 9.240 N RIMS3 n/a
2 TRCN0000433101 TGAAAGCCAGTTCAGCGATTT pLKO_005 885 CDS 100% 10.800 7.560 N RIMS3 n/a
3 TRCN0000063703 CCTCCATTCATAACCAAAGTT pLKO.1 3124 3UTR 100% 5.625 3.938 N RIMS3 n/a
4 TRCN0000063706 GGCCAAGAAGAAGACAAAGAT pLKO.1 1113 CDS 100% 5.625 3.938 N RIMS3 n/a
5 TRCN0000243912 CACCGGCTGGTACAAACTCTT pLKO_005 1305 CDS 100% 4.950 3.465 N Rims3 n/a
6 TRCN0000063707 TGACCAAGAAGACCTGTGATC pLKO.1 1133 CDS 100% 4.050 2.835 N RIMS3 n/a
7 TRCN0000063705 AGGTGGAAGTGATTGAAGCTC pLKO.1 1010 CDS 100% 2.640 1.848 N RIMS3 n/a
8 TRCN0000063704 GAGGTGGAAGTGATTGAAGCT pLKO.1 1009 CDS 100% 2.640 1.848 N RIMS3 n/a
9 TRCN0000243910 CCTCCCAGCCACCTATATCAA pLKO_005 1062 CDS 100% 5.625 3.375 N Rims3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014747.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14029 pDONR223 100% 99.8% 98% None 9_10insG n/a
2 ccsbBroad304_14029 pLX_304 0% 99.8% 98% V5 9_10insG n/a
3 TRCN0000474577 CACCTTTATCTCTCCGTTTTCGGT pLX_317 34.1% 99.8% 98% V5 9_10insG n/a
Download CSV