Transcript: Human NM_014763.4

Homo sapiens mitochondrial ribosomal protein L19 (MRPL19), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
MRPL19 (9801)
Length:
7825
CDS:
26..904

Additional Resources:

NCBI RefSeq record:
NM_014763.4
NBCI Gene record:
MRPL19 (9801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014763.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061839 CGAGATTTGCTTTGAACTTTA pLKO.1 505 CDS 100% 13.200 18.480 N MRPL19 n/a
2 TRCN0000061841 GCAGGTTCTTGAGTCCTGAAT pLKO.1 243 CDS 100% 4.950 3.960 N MRPL19 n/a
3 TRCN0000061838 GCTGGATGATAGCTTGCTATA pLKO.1 571 CDS 100% 10.800 7.560 N MRPL19 n/a
4 TRCN0000061842 GCAATATGGAAGGAAATTGAA pLKO.1 866 CDS 100% 5.625 3.938 N MRPL19 n/a
5 TRCN0000061840 GCCAGTAGTACAAGAGCCTAA pLKO.1 640 CDS 100% 4.050 2.835 N MRPL19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014763.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000471662 ACTAGGATCAGATTAAGATCTACG pLX_317 42.5% 100% 100% V5 n/a
2 ccsbBroadEn_07489 pDONR223 100% 99.8% 99.6% None 866C>T n/a
3 ccsbBroad304_07489 pLX_304 0% 99.8% 99.6% V5 866C>T n/a
Download CSV