Transcript: Human NM_014828.4

Homo sapiens TOX high mobility group box family member 4 (TOX4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-12
Taxon:
Homo sapiens (human)
Gene:
TOX4 (9878)
Length:
4514
CDS:
85..1950

Additional Resources:

NCBI RefSeq record:
NM_014828.4
NBCI Gene record:
TOX4 (9878)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014828.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336843 TTCAACCATAAGCGGTAATAG pLKO_005 2156 3UTR 100% 13.200 18.480 N TOX4 n/a
2 TRCN0000084519 CCGAGACATTCCATACACCAA pLKO.1 155 CDS 100% 2.640 3.696 N Tox4 n/a
3 TRCN0000140848 CCGAGACATTCCATACACCAA pLKO.1 155 CDS 100% 2.640 3.696 N TOX4 n/a
4 TRCN0000336898 CCGAGACATTCCATACACCAA pLKO_005 155 CDS 100% 2.640 3.696 N TOX4 n/a
5 TRCN0000142672 CCAGGGAGTATTCTTTGGATA pLKO.1 3974 3UTR 100% 4.950 3.465 N TOX4 n/a
6 TRCN0000141114 CCTTCTCAGATGGATGTTGAA pLKO.1 1735 CDS 100% 4.950 3.465 N TOX4 n/a
7 TRCN0000336842 CCTTCTCAGATGGATGTTGAA pLKO_005 1735 CDS 100% 4.950 3.465 N TOX4 n/a
8 TRCN0000141194 CTCAGAAACCAGTTTCAGCAT pLKO.1 752 CDS 100% 2.640 1.848 N TOX4 n/a
9 TRCN0000142121 GCCCAGCTAATTTGTGGTATT pLKO.1 3029 3UTR 100% 10.800 6.480 N TOX4 n/a
10 TRCN0000145434 GATCCTAATGAACCTCAGAAA pLKO.1 739 CDS 100% 4.950 2.970 N TOX4 n/a
11 TRCN0000336841 GATCCTAATGAACCTCAGAAA pLKO_005 739 CDS 100% 4.950 2.970 N TOX4 n/a
12 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3057 3UTR 100% 4.950 2.475 Y n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3128 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3128 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014828.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07501 pDONR223 100% 99.8% 100% None 1041T>C;1194G>A n/a
2 ccsbBroad304_07501 pLX_304 0% 99.8% 100% V5 1041T>C;1194G>A n/a
3 TRCN0000468555 CTAAAAGCTTGAGACCCAGTTATG pLX_317 21.8% 99.8% 100% V5 1041T>C;1194G>A n/a
Download CSV