Transcript: Human NM_014838.3

Homo sapiens zinc finger BED-type containing 4 (ZBED4), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZBED4 (9889)
Length:
6893
CDS:
476..3991

Additional Resources:

NCBI RefSeq record:
NM_014838.3
NBCI Gene record:
ZBED4 (9889)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014838.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160131 CGGTGATTTCGTTTCTGATAA pLKO.1 511 CDS 100% 13.200 18.480 N ZBED4 n/a
2 TRCN0000162912 GTTGGCTTTAACAGGCTGCTT pLKO.1 2510 CDS 100% 2.640 3.696 N ZBED4 n/a
3 TRCN0000162734 CCAAATTGACTGACTTGCCAA pLKO.1 2082 CDS 100% 2.640 2.112 N ZBED4 n/a
4 TRCN0000159159 GCAGTACAAACAGGATTTAAT pLKO.1 3544 CDS 100% 15.000 10.500 N ZBED4 n/a
5 TRCN0000161694 GCTCTGAAGCTGTCTTTCAAA pLKO.1 4805 3UTR 100% 5.625 3.938 N ZBED4 n/a
6 TRCN0000158934 GCTTGTTATATTCCAGTTGTA pLKO.1 4904 3UTR 100% 4.950 3.465 N ZBED4 n/a
7 TRCN0000162038 CCTCTGAAATGTGATCCCTTT pLKO.1 4688 3UTR 100% 4.050 2.835 N ZBED4 n/a
8 TRCN0000163124 GCTCTCCATTACGATGAACCT pLKO.1 1253 CDS 100% 2.640 1.848 N ZBED4 n/a
9 TRCN0000163125 GCACAGAATTATCAGGCGCTT pLKO.1 2370 CDS 100% 2.160 1.512 N ZBED4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014838.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07504 pDONR223 100% 99.7% 99.8% None (many diffs) n/a
2 ccsbBroad304_07504 pLX_304 0% 99.7% 99.8% V5 (many diffs) n/a
3 TRCN0000466760 GAGACAGTCGAGCAACCATATACA pLX_317 11% 99.7% 99.8% V5 (many diffs) n/a
Download CSV