Transcript: Human NM_014895.4

Homo sapiens centrosomal protein 162 (CEP162), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CEP162 (22832)
Length:
5155
CDS:
124..4335

Additional Resources:

NCBI RefSeq record:
NM_014895.4
NBCI Gene record:
CEP162 (22832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014895.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264152 AGCCGAAATAGACGTTCTTAA pLKO_005 3261 CDS 100% 13.200 18.480 N CEP162 n/a
2 TRCN0000264150 TCGGCAGAAGATACGCTTAAA pLKO_005 2838 CDS 100% 13.200 18.480 N CEP162 n/a
3 TRCN0000264148 TGAACATACTCCGCCACATTT pLKO_005 4624 3UTR 100% 13.200 18.480 N CEP162 n/a
4 TRCN0000264149 AGCAACTCAAGAGGTACTTAT pLKO_005 3882 CDS 100% 13.200 9.240 N CEP162 n/a
5 TRCN0000264151 CCATTGATTATTCGAGATTAA pLKO_005 557 CDS 100% 13.200 9.240 N CEP162 n/a
6 TRCN0000266901 TGGAACAAATGTGAGCTATTT pLKO_005 303 CDS 100% 13.200 9.240 N Cep162 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014895.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11631 pDONR223 100% 37.7% 37.4% None 1_228del;1797_1798insGTAG;1818_4209del n/a
2 ccsbBroad304_11631 pLX_304 0% 37.7% 37.4% V5 1_228del;1797_1798insGTAG;1818_4209del n/a
3 TRCN0000470069 AAAATGCGTTGGCGATTGACGTTT pLX_317 24.4% 37.7% 37.4% V5 1_228del;1797_1798insGTAG;1818_4209del n/a
Download CSV