Transcript: Human NM_014944.4

Homo sapiens calsyntenin 1 (CLSTN1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-04-20
Taxon:
Homo sapiens (human)
Gene:
CLSTN1 (22883)
Length:
5213
CDS:
794..3709

Additional Resources:

NCBI RefSeq record:
NM_014944.4
NBCI Gene record:
CLSTN1 (22883)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014944.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054258 CCAGATTTGCAGCTACGAAAT pLKO.1 1354 CDS 100% 10.800 15.120 N CLSTN1 n/a
2 TRCN0000292012 CCAGATTTGCAGCTACGAAAT pLKO_005 1354 CDS 100% 10.800 15.120 N CLSTN1 n/a
3 TRCN0000054260 GAGAAATTAAACTACGGGAAA pLKO.1 1430 CDS 100% 4.050 5.670 N CLSTN1 n/a
4 TRCN0000054261 CAGGTGAGATTTGTGGATTTA pLKO.1 1005 CDS 100% 13.200 17.160 N CLSTN1 n/a
5 TRCN0000292013 CAGGTGAGATTTGTGGATTTA pLKO_005 1005 CDS 100% 13.200 17.160 N CLSTN1 n/a
6 TRCN0000303326 TGTTGACAAAGATGGTTATAT pLKO_005 1399 CDS 100% 15.000 10.500 N CLSTN1 n/a
7 TRCN0000303327 CCACGATGTACAAAGTCATTT pLKO_005 3782 3UTR 100% 13.200 9.240 N CLSTN1 n/a
8 TRCN0000054262 CACCAGCACAATCAAGTGTTT pLKO.1 2632 CDS 100% 4.950 3.465 N CLSTN1 n/a
9 TRCN0000307941 CACCAGCACAATCAAGTGTTT pLKO_005 2632 CDS 100% 4.950 3.465 N CLSTN1 n/a
10 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 3543 CDS 100% 4.950 2.475 Y Adam32 n/a
11 TRCN0000156756 GAGGAAGAGGAAGAGGAAGAT pLKO.1 3545 CDS 100% 4.950 2.475 Y NPM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014944.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.