Transcript: Human NM_015011.3

Homo sapiens myosin XVI (MYO16), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MYO16 (23026)
Length:
7119
CDS:
374..5950

Additional Resources:

NCBI RefSeq record:
NM_015011.3
NBCI Gene record:
MYO16 (23026)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015011.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445134 ATGAACGCTCCCTACCATAAA pLKO_005 4025 CDS 100% 13.200 18.480 N MYO16 n/a
2 TRCN0000150310 CGCACCTAAATCTTGAAACTA pLKO.1 6560 3UTR 100% 5.625 7.875 N MYO16 n/a
3 TRCN0000444895 ATTCACTATCTAGTGCTATAA pLKO_005 5580 CDS 100% 13.200 10.560 N MYO16 n/a
4 TRCN0000151510 CCAGTTGCTTCATCAAGTATT pLKO.1 2022 CDS 100% 13.200 9.240 N MYO16 n/a
5 TRCN0000155527 GCCTGCGATAACCCTGATATT pLKO.1 776 CDS 100% 13.200 9.240 N MYO16 n/a
6 TRCN0000150309 CGGTATGATAATGCCTTCATT pLKO.1 677 CDS 100% 5.625 3.938 N MYO16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015011.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15004 pDONR223 97.7% 99.8% 47% None (many diffs) n/a
2 ccsbBroad304_15004 pLX_304 0% 99.8% 47% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479281 GTACTGCACTCCCCCCACAGACTG pLX_317 7.9% 99.8% 47% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV