Transcript: Human NM_015051.3

Homo sapiens endoplasmic reticulum protein 44 (ERP44), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ERP44 (23071)
Length:
4808
CDS:
161..1381

Additional Resources:

NCBI RefSeq record:
NM_015051.3
NBCI Gene record:
ERP44 (23071)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015051.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064132 GCTCGGCAATTAATAAGTGAA pLKO.1 1010 CDS 100% 4.950 6.930 N ERP44 n/a
2 TRCN0000064131 CAAGTCTTGATACAGAGAATA pLKO.1 255 CDS 100% 13.200 9.240 N ERP44 n/a
3 TRCN0000064129 CCGATGTCATTAAGGAAGAAT pLKO.1 375 CDS 100% 5.625 3.938 N ERP44 n/a
4 TRCN0000064128 GCACCCAGTGAATATAGGTAT pLKO.1 1331 CDS 100% 4.950 3.465 N ERP44 n/a
5 TRCN0000064130 CCTCTTCTGCACATACAGAAA pLKO.1 1079 CDS 100% 0.495 0.347 N ERP44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015051.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02718 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02718 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472813 CAAGGACCGATATGTAAGTTGTCA pLX_317 36% 100% 100% V5 n/a
Download CSV