Transcript: Human NM_015077.4

Homo sapiens sterile alpha and TIR motif containing 1 (SARM1), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SARM1 (23098)
Length:
10277
CDS:
340..2514

Additional Resources:

NCBI RefSeq record:
NM_015077.4
NBCI Gene record:
SARM1 (23098)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015077.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122605 GCAGATCGGTTTCTCCAAGTA pLKO.1 1605 CDS 100% 4.950 6.930 N SARM1 n/a
2 TRCN0000139922 GCACATGTTCAAGCATTCGGA pLKO.1 906 CDS 100% 0.750 1.050 N SARM1 n/a
3 TRCN0000432467 AGAACATTGTGCCCATCATTG pLKO_005 2291 CDS 100% 10.800 7.560 N SARM1 n/a
4 TRCN0000413446 TATCAAGTGGTCCCACGAATA pLKO_005 2379 CDS 100% 10.800 7.560 N SARM1 n/a
5 TRCN0000141774 GATTGGGTGCATAAGGAGATT pLKO.1 2248 CDS 100% 4.950 3.465 N SARM1 n/a
6 TRCN0000142424 GCAACTTTGTGTTGGTGCTAT pLKO.1 2183 CDS 100% 4.950 3.465 N SARM1 n/a
7 TRCN0000139869 GCAAGAACATTGTGCCCATCA pLKO.1 2288 CDS 100% 4.050 2.835 N SARM1 n/a
8 TRCN0000140206 GCCCTCACAAATCTTTGCCAT pLKO.1 3626 3UTR 100% 2.640 1.848 N SARM1 n/a
9 TRCN0000141216 CATTGAGAAGATCATCCGCTT pLKO.1 2412 CDS 100% 2.160 1.512 N SARM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015077.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.