Transcript: Human NM_015078.3

Homo sapiens MCF.2 cell line derived transforming sequence-like 2 (MCF2L2), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
MCF2L2 (23101)
Length:
5013
CDS:
293..3637

Additional Resources:

NCBI RefSeq record:
NM_015078.3
NBCI Gene record:
MCF2L2 (23101)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047575 CCAGGGATTATCTCCTCATTA pLKO.1 2962 CDS 100% 13.200 10.560 N MCF2L2 n/a
2 TRCN0000413330 ATTCACAAGGATCGTTATAAA pLKO_005 2846 CDS 100% 15.000 10.500 N MCF2L2 n/a
3 TRCN0000425776 GATCACTCATGTCGATGAAAT pLKO_005 355 CDS 100% 13.200 9.240 N MCF2L2 n/a
4 TRCN0000047574 GCTCATCCAAAGCCACCATTA pLKO.1 1450 CDS 100% 10.800 7.560 N MCF2L2 n/a
5 TRCN0000047576 CCAGATGAAGACTTCCTGAAT pLKO.1 518 CDS 100% 4.950 3.465 N MCF2L2 n/a
6 TRCN0000047573 CCAGGAAACTTACAGCTCATA pLKO.1 668 CDS 100% 4.950 3.465 N MCF2L2 n/a
7 TRCN0000047577 CGAATTTCACAACAGGACTTT pLKO.1 2323 CDS 100% 4.950 3.465 N MCF2L2 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4790 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4790 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11675 pDONR223 100% 63.5% 63.1% None (many diffs) n/a
2 ccsbBroad304_11675 pLX_304 0% 63.5% 63.1% V5 (many diffs) n/a
3 TRCN0000476383 AATCGAACAGTCTTACTCGTTTCG pLX_317 18.7% 63.5% 63.1% V5 (many diffs) n/a
Download CSV