Transcript: Human NM_015079.6

Homo sapiens TBC1 domain family member 2B (TBC1D2B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TBC1D2B (23102)
Length:
6074
CDS:
60..2804

Additional Resources:

NCBI RefSeq record:
NM_015079.6
NBCI Gene record:
TBC1D2B (23102)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015079.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022131 GCAAGATTCGATGTCTATATT pLKO.1 2693 CDS 100% 15.000 21.000 N TBC1D2B n/a
2 TRCN0000434107 CGCTACTTCACTCGCACTATC pLKO_005 2724 CDS 100% 10.800 15.120 N TBC1D2B n/a
3 TRCN0000022129 CGCCCTTTGAAAGACATAATT pLKO.1 963 CDS 100% 15.000 12.000 N TBC1D2B n/a
4 TRCN0000022133 CCAGAGATAACACTGATTTAA pLKO.1 559 CDS 100% 15.000 10.500 N TBC1D2B n/a
5 TRCN0000416341 ATCCCAGTATGACAAGTATTT pLKO_005 1181 CDS 100% 13.200 9.240 N TBC1D2B n/a
6 TRCN0000022132 CGTTAGTGACATCCTCTTTAA pLKO.1 2579 CDS 100% 13.200 9.240 N TBC1D2B n/a
7 TRCN0000423997 CTCTCAGCTCTACGAAGAAAT pLKO_005 1587 CDS 100% 13.200 9.240 N TBC1D2B n/a
8 TRCN0000420664 GAAAGTAAATACCTGATATTG pLKO_005 1674 CDS 100% 13.200 9.240 N TBC1D2B n/a
9 TRCN0000022130 GCATTTGTTAAACCTCATCTT pLKO.1 1809 CDS 100% 4.950 3.465 N TBC1D2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015079.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11676 pDONR223 100% 86.2% 86.2% None 1_378del n/a
2 TRCN0000476863 ATCCATATACTTACAGTTGACGCA pLX_317 15.5% 86.2% 86.2% V5 1_378del n/a
Download CSV