Transcript: Human NM_015120.4

Homo sapiens ALMS1 centrosome and basal body associated protein (ALMS1), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ALMS1 (7840)
Length:
12928
CDS:
112..12621

Additional Resources:

NCBI RefSeq record:
NM_015120.4
NBCI Gene record:
ALMS1 (7840)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015120.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084001 CGAGGATGAATAGTGAGTTTA pLKO.1 9344 CDS 100% 13.200 18.480 N ALMS1 n/a
2 TRCN0000428950 TATTGGCACACAGACGAATTT pLKO_005 7119 CDS 100% 13.200 18.480 N ALMS1 n/a
3 TRCN0000083999 CGGGTGTATCTAATGGTGATT pLKO.1 7040 CDS 100% 4.950 6.930 N ALMS1 n/a
4 TRCN0000420831 GTATCTCAGCACCCGCTTATA pLKO_005 997 CDS 100% 13.200 10.560 N ALMS1 n/a
5 TRCN0000084000 GCGAGGATGAATAGTGAGTTT pLKO.1 9343 CDS 100% 4.950 3.960 N ALMS1 n/a
6 TRCN0000424420 TTGTGAGTCTGGTTGAATAAA pLKO_005 12690 3UTR 100% 15.000 10.500 N ALMS1 n/a
7 TRCN0000431700 GGCATTGCTAGGTAGTCAAAT pLKO_005 4722 CDS 100% 13.200 9.240 N ALMS1 n/a
8 TRCN0000413588 CCTAGAGAAGCAGAATCCTTA pLKO_005 12666 3UTR 100% 4.950 3.465 N ALMS1 n/a
9 TRCN0000084002 CCTCTAATTCTCACTCACATA pLKO.1 2966 CDS 100% 4.950 3.465 N ALMS1 n/a
10 TRCN0000083998 GTCTGGAACAAAGTGGTGATT pLKO.1 12758 3UTR 100% 4.950 3.465 N ALMS1 n/a
11 TRCN0000143223 GCCTATCAGCAAGAAGGAAAT pLKO.1 12438 CDS 100% 10.800 5.400 Y ALMS1P1 n/a
12 TRCN0000144740 GAAATGATTCAGAGGTCCAAA pLKO.1 12454 CDS 100% 4.950 2.475 Y ALMS1P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015120.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10575 pDONR223 100% 4.1% 3.1% None (many diffs) n/a
2 ccsbBroad304_10575 pLX_304 0% 4.1% 3.1% V5 (many diffs) n/a
3 TRCN0000465840 ATATTCTCGCTCGCTTACTTGGGA pLX_317 64.3% 4.1% 3.1% V5 (many diffs) n/a
Download CSV