Transcript: Human NM_015123.3

Homo sapiens FERM domain containing 4B (FRMD4B), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FRMD4B (23150)
Length:
6283
CDS:
100..3204

Additional Resources:

NCBI RefSeq record:
NM_015123.3
NBCI Gene record:
FRMD4B (23150)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015123.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254070 CGACTTACGGTGTCCATTATT pLKO_005 857 CDS 100% 15.000 21.000 N FRMD4B n/a
2 TRCN0000254068 TCCGAGATGGACAGCGATAAG pLKO_005 2206 CDS 100% 10.800 15.120 N FRMD4B n/a
3 TRCN0000254067 TAAACTGGTCCTTAGTCATTT pLKO_005 4583 3UTR 100% 13.200 10.560 N FRMD4B n/a
4 TRCN0000265468 TTCAAGTTAGCAGCGTTTATT pLKO_005 631 CDS 100% 15.000 10.500 N FRMD4B n/a
5 TRCN0000254069 CCGAGTTCTTGACCACGATTT pLKO_005 453 CDS 100% 10.800 7.560 N FRMD4B n/a
6 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5428 3UTR 100% 4.950 2.475 Y CFLAR n/a
7 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5428 3UTR 100% 4.950 2.475 Y C19orf31 n/a
8 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5426 3UTR 100% 4.950 2.475 Y ERN2 n/a
9 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5426 3UTR 100% 4.950 2.475 Y P3H4 n/a
10 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5426 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015123.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.