Transcript: Human NM_015127.4

Homo sapiens chloride channel CLIC like 1 (CLCC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-24
Taxon:
Homo sapiens (human)
Gene:
CLCC1 (23155)
Length:
4695
CDS:
151..1656

Additional Resources:

NCBI RefSeq record:
NM_015127.4
NBCI Gene record:
CLCC1 (23155)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015127.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244652 ACGTTGTGGTTTGGTATATTG pLKO_005 2417 3UTR 100% 13.200 18.480 N CLCC1 n/a
2 TRCN0000244653 CGGAGCCATTGAAGCATATTG pLKO_005 926 CDS 100% 13.200 18.480 N CLCC1 n/a
3 TRCN0000168353 GCTCTTACTAGTCAACCCTAT pLKO.1 852 CDS 100% 0.000 0.000 N CLCC1 n/a
4 TRCN0000257150 TTTGGAGTGGATCCATATAAT pLKO_005 532 CDS 100% 15.000 12.000 N CLCC1 n/a
5 TRCN0000257146 TTCATGTGCTGAGACATATAG pLKO_005 1070 CDS 100% 13.200 9.240 N CLCC1 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2170 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2133 3UTR 100% 4.950 2.475 Y LOC387873 n/a
8 TRCN0000141125 CAGGTTCAAGAGATTCTCCTA pLKO.1 2004 3UTR 100% 2.640 1.320 Y SYNE4 n/a
9 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 3313 3UTR 100% 0.495 0.248 Y C11orf44 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2170 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015127.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07844 pDONR223 100% 99.9% 100% None 453T>C n/a
2 ccsbBroad304_07844 pLX_304 0% 99.9% 100% V5 453T>C n/a
3 TRCN0000466949 AATCTATCATGCTATATATCGTTA pLX_317 22.8% 99.9% 100% V5 453T>C n/a
Download CSV