Transcript: Human NM_015176.4

Homo sapiens F-box protein 28 (FBXO28), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
FBXO28 (23219)
Length:
5427
CDS:
20..1126

Additional Resources:

NCBI RefSeq record:
NM_015176.4
NBCI Gene record:
FBXO28 (23219)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015176.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219800 TTATGTCCTACGACGAAATTA pLKO.1 252 CDS 100% 15.000 21.000 N FBXO28 n/a
2 TRCN0000192297 CGAGAACATCCTCAGCTTTAT pLKO.1 235 CDS 100% 13.200 18.480 N Fbxo28 n/a
3 TRCN0000328354 CGAGAACATCCTCAGCTTTAT pLKO_005 235 CDS 100% 13.200 18.480 N Fbxo28 n/a
4 TRCN0000435936 TACATACGTAAGGATCTTAAA pLKO_005 1434 3UTR 100% 13.200 18.480 N FBXO28 n/a
5 TRCN0000417147 ATCTAAACGTCTTCGGAATAG pLKO_005 1099 CDS 100% 10.800 15.120 N FBXO28 n/a
6 TRCN0000219801 TAGGAACAAGAGACTATTAAA pLKO.1 1972 3UTR 100% 15.000 10.500 N FBXO28 n/a
7 TRCN0000412345 CTTAGTAGCTTAAGCAGTTAT pLKO_005 1163 3UTR 100% 13.200 9.240 N FBXO28 n/a
8 TRCN0000180818 GCAGAGCTAGAACGCAAACTA pLKO.1 971 CDS 100% 5.625 3.938 N FBXO28 n/a
9 TRCN0000147607 GAGAATGTTGAATCAGGGATT pLKO.1 316 CDS 100% 4.050 2.430 N FBXO28 n/a
10 TRCN0000180342 GCAGACATTCTTGCTGCTGTT pLKO.1 437 CDS 100% 4.050 2.430 N FBXO28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015176.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02739 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02739 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491963 GCACTAACATACGTCAGGTTATAC pLX_317 25.1% 100% 100% V5 n/a
Download CSV