Transcript: Human NM_015352.2

Homo sapiens protein O-fucosyltransferase 1 (POFUT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
POFUT1 (23509)
Length:
5226
CDS:
63..1229

Additional Resources:

NCBI RefSeq record:
NM_015352.2
NBCI Gene record:
POFUT1 (23509)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015352.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296213 GGCCAAGCCGACCACTTTATT pLKO_005 1095 CDS 100% 15.000 21.000 N POFUT1 n/a
2 TRCN0000034942 GCTACTGATTCCGAGAGTTAT pLKO.1 987 CDS 100% 13.200 18.480 N POFUT1 n/a
3 TRCN0000296214 ATGGTATGGTCAGACGAAATG pLKO_005 696 CDS 100% 10.800 15.120 N POFUT1 n/a
4 TRCN0000034939 CGGTCTACGTTGCTACTGATT pLKO.1 976 CDS 100% 4.950 6.930 N POFUT1 n/a
5 TRCN0000308130 TCTTGGGCTCTCTGGCATTTG pLKO_005 214 CDS 100% 10.800 8.640 N POFUT1 n/a
6 TRCN0000308132 GGTCATCAGCTTGGAGGATTT pLKO_005 365 CDS 100% 10.800 7.560 N POFUT1 n/a
7 TRCN0000034940 CCATGTGTCCTACCAGAAGTA pLKO.1 311 CDS 100% 4.950 3.465 N POFUT1 n/a
8 TRCN0000034943 GTTTCATGTGAGTTTCAACAA pLKO.1 524 CDS 100% 4.950 3.465 N POFUT1 n/a
9 TRCN0000289436 GTTTCATGTGAGTTTCAACAA pLKO_005 524 CDS 100% 4.950 3.465 N POFUT1 n/a
10 TRCN0000034941 CGGCCCTATGTGGGCATTCAT pLKO.1 756 CDS 100% 1.875 1.313 N POFUT1 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4699 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015352.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02783 pDONR223 100% 48.2% 47.1% None (many diffs) n/a
2 ccsbBroad304_02783 pLX_304 0% 48.2% 47.1% V5 (many diffs) n/a
3 TRCN0000473609 CGAGGATTCCATCGCAGCACAGCA pLX_317 81.3% 48.2% 47.1% V5 (many diffs) n/a
Download CSV