Transcript: Human NM_015381.7

Homo sapiens TAFA chemokine like family member 5 (TAFA5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TAFA5 (25817)
Length:
2604
CDS:
142..519

Additional Resources:

NCBI RefSeq record:
NM_015381.7
NBCI Gene record:
TAFA5 (25817)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015381.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165081 GTGGACGCAAGAATCATCAAG pLKO.1 376 CDS 100% 4.950 6.930 N TAFA5 n/a
2 TRCN0000162842 CGCAAGAATCATCAAGACCAA pLKO.1 381 CDS 100% 2.640 3.696 N TAFA5 n/a
3 TRCN0000166535 CGACTTGTTAATCAACCGGTC pLKO.1 444 CDS 100% 1.200 1.680 N TAFA5 n/a
4 TRCN0000164959 GCGACTTGTTAATCAACCGGT pLKO.1 443 CDS 100% 0.660 0.924 N TAFA5 n/a
5 TRCN0000164894 GAAGGCTGCGACTTGTTAATC pLKO.1 436 CDS 100% 13.200 9.240 N TAFA5 n/a
6 TRCN0000164056 CCGCTTTATTCCTCTGTACTT pLKO.1 1251 3UTR 100% 4.950 3.465 N TAFA5 n/a
7 TRCN0000161449 CCTCTGTACTTAGATCAACTT pLKO.1 1261 3UTR 100% 4.950 3.465 N TAFA5 n/a
8 TRCN0000162971 GAATCATCAAGACCAAGCAGT pLKO.1 386 CDS 100% 2.640 1.848 N TAFA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015381.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11769 pDONR223 100% 84.8% 78.7% None (many diffs) n/a
2 ccsbBroad304_11769 pLX_304 0% 84.8% 78.7% V5 (many diffs) n/a
3 TRCN0000475654 GGCCGTGCTGTTACGGCAGAGCGA pLX_317 82.7% 84.8% 78.7% V5 (many diffs) n/a
Download CSV