Transcript: Human NM_015388.4

Homo sapiens Yip1 domain family member 3 (YIPF3), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
YIPF3 (25844)
Length:
1507
CDS:
120..1172

Additional Resources:

NCBI RefSeq record:
NM_015388.4
NBCI Gene record:
YIPF3 (25844)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015388.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243224 CCTGTTCATCACCTATAATAT pLKO_005 815 CDS 100% 15.000 21.000 N YIPF3 n/a
2 TRCN0000175930 GATCCCTATCAAGATGGTCAA pLKO.1 530 CDS 100% 4.050 5.670 N Yipf3 n/a
3 TRCN0000340865 GATCCCTATCAAGATGGTCAA pLKO_005 530 CDS 100% 4.050 5.670 N Yipf3 n/a
4 TRCN0000193648 CCCTATCAAGATGGTCAACTT pLKO.1 533 CDS 100% 4.950 3.960 N Yipf3 n/a
5 TRCN0000243221 AGAGAGGAGGAAGACTATTAA pLKO_005 1215 3UTR 100% 15.000 10.500 N YIPF3 n/a
6 TRCN0000243220 TGAAGACGTCTGACACTATTA pLKO_005 631 CDS 100% 13.200 9.240 N YIPF3 n/a
7 TRCN0000243223 AGGCTCTAGCTTCGAGGATAT pLKO_005 248 CDS 100% 10.800 7.560 N YIPF3 n/a
8 TRCN0000172548 GTGAACTCTATGGACCTCTCA pLKO.1 571 CDS 100% 2.640 1.848 N YIPF3 n/a
9 TRCN0000243222 GGGAGTCTCATCCTTCATTTA pLKO_005 707 CDS 100% 13.200 7.920 N YIPF3 n/a
10 TRCN0000340866 GTCCTGTTCATCACCTATAAC pLKO_005 813 CDS 100% 13.200 18.480 N Yipf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015388.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07951 pDONR223 100% 99.9% 100% None 15G>T n/a
2 ccsbBroad304_07951 pLX_304 0% 99.9% 100% V5 15G>T n/a
3 TRCN0000473313 TGCGGCCATTCGTGTAACCGGAGA pLX_317 30% 99.9% 100% V5 15G>T n/a
Download CSV