Transcript: Human NM_015393.4

Homo sapiens prostate androgen-regulated mucin-like protein 1 (PARM1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PARM1 (25849)
Length:
5011
CDS:
213..1145

Additional Resources:

NCBI RefSeq record:
NM_015393.4
NBCI Gene record:
PARM1 (25849)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015393.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166726 CTTCTGGGTTCTCGTCAACAA pLKO.1 529 CDS 100% 4.950 6.930 N PARM1 n/a
2 TRCN0000166154 CATCACCCTCATCCCTATCAA pLKO.1 679 CDS 100% 5.625 4.500 N PARM1 n/a
3 TRCN0000165722 CCTCCGTTACTACCAACCATA pLKO.1 724 CDS 100% 4.950 3.465 N PARM1 n/a
4 TRCN0000160843 GATGTGTGAGCTCATAGACAT pLKO.1 899 CDS 100% 4.950 3.465 N PARM1 n/a
5 TRCN0000166727 CAACTGTGTCAGGCAAAGTGA pLKO.1 880 CDS 100% 3.000 2.100 N PARM1 n/a
6 TRCN0000158559 CTAAGAACATTTCCATAGAGT pLKO.1 445 CDS 100% 3.000 2.100 N PARM1 n/a
7 TRCN0000165237 GCATCTTAACTGCAGGATGGA pLKO.1 241 CDS 100% 2.640 1.848 N PARM1 n/a
8 TRCN0000164989 GTCAGGCAAAGTGATGTGTGA pLKO.1 887 CDS 100% 2.640 1.848 N PARM1 n/a
9 TRCN0000162383 CAAACATTGTACCACCGACTA pLKO.1 310 CDS 100% 4.050 2.835 N PARM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015393.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07952 pDONR223 100% 99.7% 99.6% None 39T>C;367G>A n/a
2 ccsbBroad304_07952 pLX_304 0% 99.7% 99.6% V5 39T>C;367G>A n/a
3 TRCN0000467462 TTGTGAGCGCACTTAAGCTAAGCC pLX_317 45% 99.7% 99.6% V5 39T>C;367G>A n/a
Download CSV