Transcript: Human NM_015473.4

Homo sapiens HEAT repeat containing 5A (HEATR5A), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
HEATR5A (25938)
Length:
7811
CDS:
154..6294

Additional Resources:

NCBI RefSeq record:
NM_015473.4
NBCI Gene record:
HEATR5A (25938)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015473.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245808 CTCAATTCTCCCTACTATATT pLKO_005 5400 CDS 100% 15.000 21.000 N HEATR5A n/a
2 TRCN0000245811 TATGACCCTTATTCGATTTAT pLKO_005 2428 CDS 100% 15.000 21.000 N HEATR5A n/a
3 TRCN0000245809 ATGTTCTACATCGAGTAATTT pLKO_005 4994 CDS 100% 15.000 10.500 N HEATR5A n/a
4 TRCN0000245810 TCTGCTGGCCCACTCTATTAT pLKO_005 3058 CDS 100% 15.000 10.500 N HEATR5A n/a
5 TRCN0000245807 CCAGTATACAATAGTACAAAT pLKO_005 7112 3UTR 100% 13.200 9.240 N HEATR5A n/a
6 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 6804 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015473.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11785 pDONR223 100% 5.5% 5.5% None 339_6138delinsG n/a
2 ccsbBroad304_11785 pLX_304 0% 5.5% 5.5% V5 339_6138delinsG n/a
Download CSV