Transcript: Human NM_015509.4

Homo sapiens NECAP endocytosis associated 1 (NECAP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NECAP1 (25977)
Length:
2634
CDS:
16..843

Additional Resources:

NCBI RefSeq record:
NM_015509.4
NBCI Gene record:
NECAP1 (25977)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015509.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136442 CAAGTTGTGTATCGGGAACAT pLKO.1 492 CDS 100% 4.950 6.930 N NECAP1 n/a
2 TRCN0000161357 CCCATTCCGAAATCTAACCAT pLKO.1 655 CDS 100% 3.000 4.200 N NECAP1 n/a
3 TRCN0000133764 CAGTAGAACAATATCCTGGTA pLKO.1 233 CDS 100% 2.640 3.696 N NECAP1 n/a
4 TRCN0000162301 CATCAAGTTGTGTATCGGGAA pLKO.1 489 CDS 100% 2.160 3.024 N NECAP1 n/a
5 TRCN0000164015 CGCAGTGCTTTCATTGGCATT pLKO.1 319 CDS 100% 4.050 3.240 N NECAP1 n/a
6 TRCN0000162358 CGACTTTAATGTCTCCTTGCA pLKO.1 366 CDS 100% 2.640 2.112 N NECAP1 n/a
7 TRCN0000160346 CCCTTTCCATAAACATTTCTT pLKO.1 1811 3UTR 100% 5.625 3.938 N NECAP1 n/a
8 TRCN0000162887 GCCCTGCCATTCCTATTACAA pLKO.1 2002 3UTR 100% 5.625 3.938 N NECAP1 n/a
9 TRCN0000162003 GCAGTGATGCAGATATCCTTT pLKO.1 680 CDS 100% 4.950 3.465 N NECAP1 n/a
10 TRCN0000159038 GAATCTGAGATTTCCAAGGAA pLKO.1 412 CDS 100% 3.000 2.100 N NECAP1 n/a
11 TRCN0000133904 CTTCGACTTTAATGTCTCCTT pLKO.1 363 CDS 100% 2.640 1.848 N NECAP1 n/a
12 TRCN0000164649 GCTGCATTTGAAGCATGGCAT pLKO.1 1655 3UTR 100% 2.640 1.848 N NECAP1 n/a
13 TRCN0000163488 GCTCTATTCTTGCAGAGCCAT pLKO.1 2265 3UTR 100% 0.264 0.185 N NECAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015509.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11795 pDONR223 100% 48.3% 48.3% None 1_426del n/a
2 ccsbBroad304_11795 pLX_304 0% 48.3% 48.3% V5 1_426del n/a
3 TRCN0000474257 CTCTCACCCCTGCTGTGTTTGGCC pLX_317 90.6% 48.3% 48.3% V5 1_426del n/a
Download CSV