Transcript: Human NM_015542.4

Homo sapiens UPF2 regulator of nonsense mediated mRNA decay (UPF2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
UPF2 (26019)
Length:
5168
CDS:
74..3892

Additional Resources:

NCBI RefSeq record:
NM_015542.4
NBCI Gene record:
UPF2 (26019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015542.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338828 CGATTAGGAATGGAGGTTAAT pLKO_005 2633 CDS 100% 13.200 18.480 N UPF2 n/a
2 TRCN0000242163 CTAGAGAGTTGCGAATCTAAA pLKO_005 3997 3UTR 100% 13.200 18.480 N Upf2 n/a
3 TRCN0000219987 GGTATCAAGTCCCGATGATTT pLKO.1 1606 CDS 100% 13.200 18.480 N UPF2 n/a
4 TRCN0000158254 CGCGAGGGTTAATCTTCTCTT pLKO.1 4124 3UTR 100% 4.950 6.930 N UPF2 n/a
5 TRCN0000338827 CGCGAGGGTTAATCTTCTCTT pLKO_005 4124 3UTR 100% 4.950 6.930 N UPF2 n/a
6 TRCN0000152872 GCGTTATGTTTGGTGGAAGAA pLKO.1 2923 CDS 100% 4.950 6.930 N UPF2 n/a
7 TRCN0000338889 GCGTTATGTTTGGTGGAAGAA pLKO_005 2923 CDS 100% 4.950 6.930 N UPF2 n/a
8 TRCN0000157152 GCGAGATACGTCACAATGGTA pLKO.1 2297 CDS 100% 3.000 4.200 N UPF2 n/a
9 TRCN0000338826 GCGAGATACGTCACAATGGTA pLKO_005 2297 CDS 100% 3.000 4.200 N UPF2 n/a
10 TRCN0000157489 GCACCAACTAGATGTTGCCAT pLKO.1 3478 CDS 100% 2.640 2.112 N UPF2 n/a
11 TRCN0000219988 CATCAGAGTCAGTGCTATAAA pLKO.1 4526 3UTR 100% 15.000 10.500 N UPF2 n/a
12 TRCN0000242164 AGCACCTAATGCAGATCTAAT pLKO_005 3844 CDS 100% 13.200 9.240 N Upf2 n/a
13 TRCN0000151546 GACTTCTCTCATCACCATATT pLKO.1 2153 CDS 100% 13.200 9.240 N UPF2 n/a
14 TRCN0000150629 GAACTTGAGTTGGAGAATCTA pLKO.1 1628 CDS 100% 5.625 3.938 N UPF2 n/a
15 TRCN0000151381 GACTTGTACCAAGGAAAGTAA pLKO.1 1035 CDS 100% 5.625 3.938 N UPF2 n/a
16 TRCN0000153627 CACCAACTAGATGTTGCCATT pLKO.1 3479 CDS 100% 4.050 2.835 N UPF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015542.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.