Transcript: Human NM_015544.3

Homo sapiens transmembrane protein 98 (TMEM98), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
TMEM98 (26022)
Length:
4218
CDS:
216..896

Additional Resources:

NCBI RefSeq record:
NM_015544.3
NBCI Gene record:
TMEM98 (26022)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015544.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243374 CAGCTGTGTGTGCATAGTAAA pLKO_005 1009 3UTR 100% 13.200 18.480 N TMEM98 n/a
2 TRCN0000178773 CGCTATGATTCTAAGCCCATT pLKO.1 333 CDS 100% 4.050 5.670 N TMEM98 n/a
3 TRCN0000243377 CAGGAGCAGTCTGCAATTTAG pLKO_005 876 CDS 100% 13.200 9.240 N TMEM98 n/a
4 TRCN0000243375 TAGCTTCTGAGCCAGATAAAG pLKO_005 829 CDS 100% 13.200 9.240 N TMEM98 n/a
5 TRCN0000243376 CCAGTGTCAGCGACATCATTG pLKO_005 583 CDS 100% 10.800 7.560 N TMEM98 n/a
6 TRCN0000243373 GAACTGGACGATGTCGTTATC pLKO_005 402 CDS 100% 10.800 7.560 N TMEM98 n/a
7 TRCN0000180675 CACCATCTTTCTGGCTTCGTT pLKO.1 254 CDS 100% 3.000 2.100 N TMEM98 n/a
8 TRCN0000181089 CCACTGCATTGCCATCTTGAA pLKO.1 491 CDS 100% 4.950 2.970 N TMEM98 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015544.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02905 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02905 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474182 ATCCAGACCCGACATCTAAACTCT pLX_317 63.3% 100% 100% V5 n/a
Download CSV