Transcript: Human NM_015595.4

Homo sapiens Rho guanine nucleotide exchange factor 26 (ARHGEF26), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ARHGEF26 (26084)
Length:
5149
CDS:
182..2797

Additional Resources:

NCBI RefSeq record:
NM_015595.4
NBCI Gene record:
ARHGEF26 (26084)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015595.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423258 CAAATGGCCTTGCCGCTAATA pLKO_005 705 CDS 100% 13.200 18.480 N ARHGEF26 n/a
2 TRCN0000048289 CGGGTTACTAATTACGGATTT pLKO.1 313 CDS 100% 10.800 15.120 N ARHGEF26 n/a
3 TRCN0000048291 CCGAAGTATGAAGTCTGCAAA pLKO.1 1982 CDS 100% 4.950 6.930 N ARHGEF26 n/a
4 TRCN0000436232 TAGCAAGTTGGTTCGACTATG pLKO_005 2020 CDS 100% 10.800 8.640 N ARHGEF26 n/a
5 TRCN0000413720 ATATCCTCTGAACATTCATAT pLKO_005 1523 CDS 100% 13.200 9.240 N ARHGEF26 n/a
6 TRCN0000415924 ATGTCAAGCTACAATTGATAA pLKO_005 2728 CDS 100% 13.200 9.240 N ARHGEF26 n/a
7 TRCN0000415484 AGAGACAAGAGGCTATCTTTG pLKO_005 1497 CDS 100% 10.800 7.560 N ARHGEF26 n/a
8 TRCN0000425125 ATCTCTGCTCCTCCTAGTTTC pLKO_005 3067 3UTR 100% 10.800 7.560 N ARHGEF26 n/a
9 TRCN0000048288 GCATCCACATTTGACCCATAT pLKO.1 1748 CDS 100% 10.800 7.560 N ARHGEF26 n/a
10 TRCN0000424184 TCCTTAAGAGATCAGCTATTG pLKO_005 2300 CDS 100% 10.800 7.560 N ARHGEF26 n/a
11 TRCN0000048292 GCAAGTCTACTTCTTTCTCTT pLKO.1 2218 CDS 100% 4.950 3.465 N ARHGEF26 n/a
12 TRCN0000048290 CGCGAATGAGAAAGTGGAGAT pLKO.1 2440 CDS 100% 4.050 2.835 N ARHGEF26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015595.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11806 pDONR223 100% 34.5% 34.4% None 1_1710del;2061C>G n/a
2 ccsbBroad304_11806 pLX_304 0% 34.5% 34.4% V5 1_1710del;2061C>G n/a
3 TRCN0000474724 GTCAACTGGGGCATCTGGCACCTC pLX_317 44% 34.5% 34.4% V5 1_1710del;2061C>G n/a
Download CSV