Construct: ORF TRCN0000474724
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010246.1_s317c1
- Derived from:
- ccsbBroadEn_11806
- DNA Barcode:
- GTCAACTGGGGCATCTGGCACCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGEF26 (26084)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474724
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 26084 | ARHGEF26 | Rho guanine nucleotide exch... | XM_017006160.1 | 59.3% | 59.1% | 1_618del;969C>G |
2 | human | 26084 | ARHGEF26 | Rho guanine nucleotide exch... | NM_001251962.1 | 34.5% | 34.4% | 1_1710del;2061C>G |
3 | human | 26084 | ARHGEF26 | Rho guanine nucleotide exch... | NM_015595.4 | 34.5% | 34.4% | 1_1710del;2061C>G |
4 | human | 26084 | ARHGEF26 | Rho guanine nucleotide exch... | XM_011512672.1 | 31% | 30.9% | 1_1710del;1842_1843ins90;1971C>G |
5 | human | 26084 | ARHGEF26 | Rho guanine nucleotide exch... | NM_001251963.2 | 25.2% | 25% | (many diffs) |
6 | mouse | 622434 | Arhgef26 | Rho guanine nucleotide exch... | NM_001081295.1 | 31% | 33.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 969
- ORF length:
- 903
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat ctcttttctc attctcccca tgcagagggt gacccgcctt cccctgctga 121 tggatactat ctgtcaaaaa acacctaagg actctccgaa gtatgaagtc tgcaaaagag 181 ccttgaagga agttagcaag ttggttcgac tatgcaatga gggcgcccgg aagatggaaa 241 ggactgagat gatgtacaca attaactccc agctggaatt taaaattaag ccttttcctt 301 tagtctcctc ttcccggtgg ttggtaaaaa gaggtgaatt gacagcctat gttgaagaca 361 ctgtgctttt ctcaagaagg acatccaaac agcaagtcta cttctttctc tttaaggatg 421 tgctcattat caccaagaag aagagtgaag aaagttacaa cgtcaatgat tattccttaa 481 gagatcagct attggtggaa tcttgtgaca atgaagagct taattcttct ccagggaaga 541 acagctccac aatgctctat tcaagacaga gcTCTGCCAG TCACCTCTTT ACTCTGACAG 601 TCCTTAGTAA CCACGCGAAT GAGAAAGTGG AGATGCTACT AGGAGCTGAG ACGCAGAGCG 661 AGCGAGCCCG CTGGATAACT GCCCTGGGAC ACAGCAGCGG GAAGCCGCCT GCAGACCGAA 721 CCTCACTGAC CCAGGTGGAA ATCGTTAGGT CATTTACTGC TAAGCAGCCA GATGAACTCT 781 CCCTGCAGGT GGCTGACGTC GTCCTCATCT ATCAACGTGT CAGCGATGGC TGGTATGAGG 841 GGGAACGACT ACGAGATGGA GAAAGAGGCT GGTTTCCTAT GGAATGTGCC AAGGAGATAA 901 CATGTCAAGC TACAATTGAT AAGAATGTGG AGAGAATGGG ACGCTTGCTA GGACTGGAGA 961 CCAACGTGTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1021 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1081 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGTCAAC TGGGGCATCT GGCACCTCAC 1141 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt