Transcript: Human NM_015596.3

Homo sapiens kallikrein related peptidase 13 (KLK13), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
KLK13 (26085)
Length:
1820
CDS:
26..859

Additional Resources:

NCBI RefSeq record:
NM_015596.3
NBCI Gene record:
KLK13 (26085)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015596.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372698 ACTGCCGCACACTGTCTAAAG pLKO_005 242 CDS 100% 10.800 15.120 N KLK13 n/a
2 TRCN0000046949 GATCCGTGAAACAATCCGAAA pLKO.1 796 CDS 100% 4.050 5.670 N KLK13 n/a
3 TRCN0000046952 GTCTGTAACAGAACACTGTAT pLKO.1 692 CDS 100% 4.950 3.960 N KLK13 n/a
4 TRCN0000372699 GGTTGAAGGGCCCACAATAAA pLKO_005 840 CDS 100% 15.000 10.500 N KLK13 n/a
5 TRCN0000372697 GCTCAATCTCAGCTAACATTC pLKO_005 982 3UTR 100% 10.800 7.560 N KLK13 n/a
6 TRCN0000265663 TGAACCACGACCATGACATCA pLKO_005 381 CDS 100% 4.950 3.465 N Klk13 n/a
7 TRCN0000046951 CACGACCATGACATCATGCTT pLKO.1 386 CDS 100% 3.000 2.100 N KLK13 n/a
8 TRCN0000046950 GCTCAAAGTTTACCTAGGCAA pLKO.1 268 CDS 100% 2.640 1.848 N KLK13 n/a
9 TRCN0000046948 CCCAGGAAAGATCACTGACAA pLKO.1 604 CDS 100% 4.950 2.970 N KLK13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015596.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02911 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02911 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474298 GGTCTTTTAATACGGATCGAGTAT pLX_317 45.9% 100% 100% V5 n/a
Download CSV