Transcript: Human NM_015603.3

Homo sapiens coiled-coil domain containing 9 (CCDC9), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CCDC9 (26093)
Length:
2027
CDS:
157..1752

Additional Resources:

NCBI RefSeq record:
NM_015603.3
NBCI Gene record:
CCDC9 (26093)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015603.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244794 ATGAACCATCCCACCGCTATG pLKO_005 1085 CDS 100% 6.000 8.400 N CCDC9 n/a
2 TRCN0000172655 GAAGACCGATGGGATGTTCAA pLKO.1 1044 CDS 100% 4.950 6.930 N CCDC9 n/a
3 TRCN0000244791 ATGAAGAATGGGAGGACATAA pLKO_005 1418 CDS 100% 13.200 9.240 N CCDC9 n/a
4 TRCN0000257021 CTCAATCTCTGACCGTAAATC pLKO_005 594 CDS 100% 13.200 9.240 N CCDC9 n/a
5 TRCN0000244793 TGGAGAAGATCGCCGAGTATG pLKO_005 668 CDS 100% 10.800 7.560 N CCDC9 n/a
6 TRCN0000244792 TTGAGGAAGACCGTAAGAAAG pLKO_005 269 CDS 100% 10.800 7.560 N CCDC9 n/a
7 TRCN0000166878 CAGAACATTGAGAAGATGAAT pLKO.1 640 CDS 100% 5.625 3.938 N CCDC9 n/a
8 TRCN0000167446 GCAGAACATTGAGAAGATGAA pLKO.1 639 CDS 100% 4.950 3.465 N CCDC9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015603.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02914 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02914 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472469 CGAGGACCATCACGTCGTGGGGCA pLX_317 28% 100% 100% V5 n/a
Download CSV