Transcript: Human NM_015653.5

Homo sapiens RIB43A domain with coiled-coils 2 (RIBC2), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
RIBC2 (26150)
Length:
1490
CDS:
195..1343

Additional Resources:

NCBI RefSeq record:
NM_015653.5
NBCI Gene record:
RIBC2 (26150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015653.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243070 CCAGAAACTCGCCGTGAATTT pLKO_005 519 CDS 100% 13.200 18.480 N RIBC2 n/a
2 TRCN0000243074 ATTCATGGGAGAGGATTTAAA pLKO_005 629 CDS 100% 15.000 10.500 N RIBC2 n/a
3 TRCN0000243072 ATCTCTGTAGGGCTATCAATG pLKO_005 475 CDS 100% 10.800 7.560 N RIBC2 n/a
4 TRCN0000166901 CAGATAATGATGTTCGGAATA pLKO.1 589 CDS 100% 10.800 7.560 N RIBC2 n/a
5 TRCN0000243073 CAGATAATGATGTTCGGAATA pLKO_005 589 CDS 100% 10.800 7.560 N RIBC2 n/a
6 TRCN0000243071 CCTAGTCCAGAAGCAGCAAAT pLKO_005 1064 CDS 100% 10.800 7.560 N RIBC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015653.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11818 pDONR223 100% 80.8% 80.8% None 1_219del n/a
2 ccsbBroad304_11818 pLX_304 0% 80.8% 80.8% V5 1_219del n/a
3 TRCN0000470313 ACTCCGAGAGACGGAGCACACTAC pLX_317 40.7% 80.8% 80.8% V5 1_219del n/a
Download CSV