Transcript: Mouse NM_015745.2

Mus musculus retinol binding protein 3, interstitial (Rbp3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rbp3 (19661)
Length:
5276
CDS:
76..3780

Additional Resources:

NCBI RefSeq record:
NM_015745.2
NBCI Gene record:
Rbp3 (19661)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101952 CGCCGAGGAATTTACTTACAT pLKO.1 3519 CDS 100% 5.625 7.875 N Rbp3 n/a
2 TRCN0000101950 GCACCTGTATTGTCTAGCCTT pLKO.1 4861 3UTR 100% 2.640 3.696 N Rbp3 n/a
3 TRCN0000101951 CGAGGAATTTACTTACATCAT pLKO.1 3522 CDS 100% 4.950 3.960 N Rbp3 n/a
4 TRCN0000101953 CGGCTCTTTACCACCTATGAT pLKO.1 1582 CDS 100% 5.625 3.938 N Rbp3 n/a
5 TRCN0000101954 CCCACGACTCTTCATCTCTTA pLKO.1 327 CDS 100% 4.950 2.970 N Rbp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06851 pDONR223 100% 81.6% 84.3% None (many diffs) n/a
2 ccsbBroad304_06851 pLX_304 0% 81.6% 84.3% V5 (many diffs) n/a
3 TRCN0000469167 TAAAAAGGTTGAGCGTTAAGCGAA pLX_317 8.7% 81.6% 84.3% V5 (many diffs) n/a
Download CSV