Transcript: Mouse NM_015792.2

Mus musculus F-box protein 18 (Fbxo18), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-24
Taxon:
Mus musculus (mouse)
Gene:
Fbxo18 (50755)
Length:
3572
CDS:
154..3282

Additional Resources:

NCBI RefSeq record:
NM_015792.2
NBCI Gene record:
Fbxo18 (50755)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120959 CGAGGATGTCAGAGATATATT pLKO.1 313 CDS 100% 15.000 12.000 N Fbxo18 n/a
2 TRCN0000328419 CGAGGATGTCAGAGATATATT pLKO_005 313 CDS 100% 15.000 12.000 N Fbxo18 n/a
3 TRCN0000328420 AGATGTCACCGAGACCTTATA pLKO_005 1281 CDS 100% 13.200 9.240 N Fbxo18 n/a
4 TRCN0000120958 CCTGCAAGGATACATTTGATT pLKO.1 2449 CDS 100% 5.625 3.938 N Fbxo18 n/a
5 TRCN0000120961 GCATACCAAATGACACATGAT pLKO.1 2005 CDS 100% 4.950 3.465 N Fbxo18 n/a
6 TRCN0000120960 GTCTCTATCCTAGACCCAGAA pLKO.1 272 CDS 100% 4.050 2.835 N Fbxo18 n/a
7 TRCN0000328351 GTCTCTATCCTAGACCCAGAA pLKO_005 272 CDS 100% 4.050 2.835 N Fbxo18 n/a
8 TRCN0000051664 CCTGACTCATACTATGGGCTT pLKO.1 724 CDS 100% 2.160 1.512 N FBH1 n/a
9 TRCN0000120957 GCATCTCTGAGGAGGAAGATA pLKO.1 3358 3UTR 100% 5.625 3.375 N Fbxo18 n/a
10 TRCN0000353414 GCATCTCTGAGGAGGAAGATA pLKO_005 3358 3UTR 100% 5.625 3.375 N Fbxo18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16047 pDONR223 0% 66.7% 71.2% None (many diffs) n/a
2 ccsbBroad304_16047 pLX_304 0% 66.7% 71.2% V5 (many diffs) n/a
Download CSV