Transcript: Mouse NM_015808.1

Mus musculus keratin associated protein 5-1 (Krtap5-1), mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
Krtap5-1 (50774)
Length:
693
CDS:
1..693

Additional Resources:

NCBI RefSeq record:
NM_015808.1
NBCI Gene record:
Krtap5-1 (50774)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098461 CAAGCCTGTGTGTTGCTGTAA pLKO.1 129 CDS 100% 4.950 2.970 N Krtap5-1 n/a
2 TRCN0000098460 GCTGTTGTGTTCCTGTCTGTT pLKO.1 158 CDS 100% 4.950 2.475 Y Krtap5-1 n/a
3 TRCN0000098462 CTGTCAGTCTAGCTGCTGCAA pLKO.1 531 CDS 100% 2.640 1.320 Y Krtap5-1 n/a
4 TRCN0000098463 GCTGCTGCAAGCCTGTGTGTT pLKO.1 122 CDS 100% 1.650 0.825 Y Krtap5-1 n/a
5 TRCN0000098413 GCTGCTGTGTGCCTGTCTGTT pLKO.1 278 CDS 100% 1.650 0.825 Y Krtap5-4 n/a
6 TRCN0000098436 GCTGTCAGTCTAGCTGCTGCA pLKO.1 530 CDS 100% 0.720 0.360 Y Krtap9-1 n/a
7 TRCN0000098464 GCTGCTGCAAGCCCTGCTGTT pLKO.1 542 CDS 100% 0.000 0.000 Y Krtap5-1 n/a
8 TRCN0000436596 TCTTCAGGCTGTGGGTCTTCT pLKO_005 364 CDS 100% 4.950 2.475 Y Krtap5-4 n/a
9 TRCN0000254822 AGCTGCTGCAAACCCTGCTGT pLKO_005 343 CDS 100% 0.880 0.440 Y KRTAP5-3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00915 pDONR223 100% 56.6% 59.1% None (many diffs) n/a
2 ccsbBroad304_00915 pLX_304 0% 56.6% 59.1% V5 (many diffs) n/a
3 TRCN0000473555 AATCGCAAATACTACCTAGATCGT pLX_317 94.8% 56.6% 59.1% V5 (many diffs) n/a
Download CSV