Transcript: Human NM_015859.4

Homo sapiens general transcription factor IIA subunit 1 (GTF2A1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
GTF2A1 (2957)
Length:
6343
CDS:
442..1572

Additional Resources:

NCBI RefSeq record:
NM_015859.4
NBCI Gene record:
GTF2A1 (2957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015859.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229653 TATGCCAATATGATAAGATAC pLKO_005 1448 CDS 100% 10.800 15.120 N GTF2A1 n/a
2 TRCN0000229651 AGCCAATGGTGCCCAATATAT pLKO_005 945 CDS 100% 15.000 10.500 N GTF2A1 n/a
3 TRCN0000229650 GCCACAGCACCACAAGTTATT pLKO_005 778 CDS 100% 13.200 9.240 N GTF2A1 n/a
4 TRCN0000229652 GTTCTACAACAACAGGTTATA pLKO_005 988 CDS 100% 13.200 9.240 N GTF2A1 n/a
5 TRCN0000218912 TCATCTCAAGGATGGCATTAT pLKO_005 1494 CDS 100% 13.200 9.240 N GTF2A1 n/a
6 TRCN0000020553 AGGAACTCTTTGACACAGAAA pLKO.1 1418 CDS 100% 4.950 3.465 N GTF2A1 n/a
7 TRCN0000020551 GCTCCATTGGTCTTACAAGTT pLKO.1 1240 CDS 100% 4.950 3.465 N GTF2A1 n/a
8 TRCN0000020552 GTGGAGTACAAGCTCCTGTTA pLKO.1 1025 CDS 100% 4.950 3.465 N GTF2A1 n/a
9 TRCN0000020550 CCACAAGTTATTGTTCCAGAT pLKO.1 787 CDS 100% 4.050 2.835 N GTF2A1 n/a
10 TRCN0000020549 GCTTTTTTTCTTTTATAAATA pLKO.1 1579 3UTR 100% 0.000 0.000 N GTF2A1 n/a
11 TRCN0000018931 GAAGAAGATGAAGATGAAGAA pLKO.1 1285 CDS 100% 4.950 2.475 Y HMGB1 n/a
12 TRCN0000093082 GAAGATGAAGATGAAGAAGAA pLKO.1 1288 CDS 100% 4.950 2.475 Y Gm5518 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015859.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00705 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00705 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479009 AGTCAGTTCTCCTAAGGACCGCTC pLX_317 35.7% 100% 100% V5 n/a
Download CSV